added test files and readme for gfastats

.gitignore

@@ -0,0 +1,2 @@
+
+.DS_Store

README.md

@@ -10,6 +10,9 @@ Research Assistant Professor, The Rockefeller University
 Cassidy Johnson  
 Graduate Fellow, The Rockefeller University
 
+Jack Medico
+Graduate Fellow, The Rockefeller University
+
 ## Description
 
 By the end of this session you will be able to:
@@ -31,3 +34,8 @@ By the end of this session you will be able to:
     Please also read the description carefully to see if this session is relevant to you.
 
     If you don't meet the prerequisites or change your mind based on the description or are no longer available at the session time, please email tol-training at sanger.ac.uk to cancel your slot so that someone else on the waitlist might attend.
+
+## Training material
+
+Gfastats examples can be found [here](https://github.com/BGAcademy23/gfastar/docs/gfastats.md).
+Kreeq examples can be found [here](https://github.com/BGAcademy23/gfastar/docs/kreeq.md).

docs/gfastats.md

@@ -0,0 +1,85 @@
+Help:
+`gfastats -h`
+File:
+cat testFiles/random1.fasta `
+Summary statistics:
+`gfastats testFiles/random1.fasta`
+Tabular output:
+`gfastats testFiles/random1.fasta -t`
+Change locale:
+`gfastats large_input.fasta.gz --locale en_US.UTF-8`
+Full output:
+`gfastats testFiles/random1.fasta --nstar-report`
+Report by sequence:
+`gfastats testFiles/random1.fasta --seq-report`
+Original file:
+`gfastats testFiles/random1.fasta -ofa`
+Line length:
+`gfastats testFiles/random1.fasta -ofa --line-length 2`
+Subset:
+`gfastats testFiles/random1.fasta Header2 -ofa`
+Subset with bed:
+`gfastats testFiles/random1.fasta -e <(echo Header2) -ofa`
+cat testFiles/random1.fasta.bed`
+`gfastats testFiles/random1.fasta -ofa -e testFiles/random1.fasta.bed`
+`gfastats testFiles/random1.fasta -ofa -i testFiles/random1.fasta.bed`
+Size of components:
+`gfastats testFiles/random1.fasta -s s`
+`gfastats testFiles/random1.fasta -s c`
+`gfastats testFiles/random1.fasta -s g`
+AGP:
+`gfastats testFiles/random1.fasta -b a`
+BED coordinates:
+`gfastats testFiles/random1.fasta -b s`
+`gfastats testFiles/random1.fasta -b c`
+`gfastats testFiles/random1.fasta -b g`
+Sorting:
+`gfastats testFiles/random1.fasta -ofa --sort largest`
+`gfastats testFiles/random1.fasta -ofa --sort descending`
+`gfastats testFiles/random1.fasta -ofa --sort test.sort`
+GFA2:
+`gfastats testFiles/random1.gfa2 -o gfa2`
+GFA2 to FASTA conversion:
+`gfastats testFiles/random1.gfa2 -o fasta`
+GFA2 to GFA1 conversion:
+`gfastats testFiles/random1.gfa2 -o gfa`
+GFA1:
+`gfastats testFiles/random2.gfa -o gfa`
+GFA1 to FASTA:
+`gfastats testFiles/random2.gfa -o fasta`
+GFA1 to GFA2:
+`gfastats testFiles/random2.gfa -o gfa2`
+GFA1 no sequence:
+`gfastats testFiles/random2.noseq.gfa -o gfa`
+GFA1 no sequence:
+`gfastats testFiles/random2.noseq.gfa -o fa`
+Homopolymer compression:
+`gfastats testFiles/random1.fasta --homopolymer-compress 1 -ofa`
+Find terminal overlaps:
+`gfastats testFiles/random5.findovl.gfa -ogfa`
+`gfastats testFiles/random5.findovl.gfa --discover-terminal-overlaps 3 -ogfa`
+Discover paths:
+`gfastats testFiles/random1.fasta -ogfa | grep -v "^P" > test.gfa`
+`gfastats test.gfa -ogfa`
+`gfastats test.gfa -ogfa2 --discover-paths`
+Superimpose AGP:
+`gfastats testFiles/random1.fasta -a testFiles/random1.agp -ofa`
+SAK reverse complement:
+`cat testFiles/random1.rvcp.sak`
+`gfastats testFiles/random1.fasta -ofa`
+`gfastats testFiles/random1.fasta -k testFiles/random1.rvcp.sak -ofa`
+Other SAK instructions:
+`cat testFiles/random1.instructions.sak`
+`gfastats testFiles/random1.fasta -ofa`
+`gfastats testFiles/random1.fasta -ofa -k <(head -1 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -2 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -3 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -4 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ogfa2 -k <(head -4 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -5 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ogfa2 -k <(head -5 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -6 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ogfa2 -k <(head -6 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ogfa2 -k <(head -6 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ogfa2 -k <(head -7 testFiles/random1.instructions.sak)`
+`gfastats testFiles/random1.fasta -ofa -k <(head -8 testFiles/random1.instructions.sak)`

docs/kreeq.md

@@ -0,0 +1,28 @@
+```
+kreeq validate -f input.[fasta|fastq][.gz] -r reads1.fastq[.gz] reads2.fastq[.gz] [...] [-k 21]
+```
+
+It accepts multiple read files as input, separated by space. To check out all options and flags use `kreeq -h`.
+
+You can test some typical usage with the files in the `testFiles` folder, e.g.:
+
+```
+kreeq validate -f testFiles/random1.fasta -r testFiles/random1.fastq
+```
+
+Importantly, the kreeq database can only be computed once on the read set, and reused for multiple analyses to save runtime:
+
+```
+kreeq validate -r testFiles/random1.fastq -o db.kreeq
+kreeq validate -f testFiles/random1.fasta -d db.kreeq
+```
+
+Similarly, kreeq databases can be generated separately for multiple inputs and combined, with increased performance in HPC environments:
+
+```
+kreeq validate -r testFiles/random1.fastq -o random1.kreeq
+kreeq validate -r testFiles/random2.fastq -o random2.kreeq
+
+kreeq union -d random1.kreeq random2.kreeq -o union.kreeq
+kreeq validate -f testFiles/random1.fasta -d union.kreeq
+```

docs/testFiles/random1.agp

@@ -0,0 +1,8 @@
+newpath1	1	5	1	W	Header1	2	5	+
+newpath1	6	10	2	N	5	scaffold	yes
+newpath1	11	13	3	W	Header2	1	3	-
+newpath1	14	18	4	N	5	scaffold	yes
+newpath1	19	24	5	W	Header3	4	8	+
+newpath2	1	5	1	W	Header5	3	7	-
+newpath2	6	10	2	N	5	scaffold	yes
+newpath2	11	25	3	W	Header4	1	15	+

docs/testFiles/random1.fasta

@@ -0,0 +1,15 @@
+>Header1 5bp sequence with no gaps and 2 lowercase bases
+CGa
+cT
+>Header2 5bp sequence with internal 1bp non-canonical gap
+CG
+AXT
+>Header3 10bp sequence with internal 4bp and 1bp terminal canonical gap
+TGANA
+TNCTN
+>Header4 15bp sequence with start 3bp canonical gap and 3 lowercase bases
+NNNTTCC
+TcgCACtC
+>Header5 15bp sequence with terminal 3bp canonical gap
+AACTCGAT
+CACGNNN

docs/testFiles/random1.fasta.bed

@@ -0,0 +1,8 @@
+Header1	0	5
+Header2	0	3
+Header2	4	5
+Header3	0	3
+Header3	4	6
+Header3	7	9
+Header4	2	13
+Header5	3	14

docs/testFiles/random1.gfa2

@@ -0,0 +1,20 @@
+H	VN:Z:2.0
+S	Header1.1	5	CGacT
+S	Header2.1	3	CGA
+S	Header2.3	1	T
+S	Header3.1	3	TGA
+S	Header3.3	2	AT
+S	Header3.5	2	CT
+S	Header4.2	12	TTCCTcgCACtC
+S	Header5.1	12	AACTCGATCACG
+G	Header2.2	Header2.1+	Header2.3+	1
+G	Header3.2	Header3.1+	Header3.3+	1
+G	Header3.4	Header3.3+	Header3.5+	1
+G	Header3.6	Header3.5+	Header3.5-	1
+G	Header4.1	Header4.2+	Header4.2+	3
+G	Header5.2	Header5.1+	Header5.1-	3
+O	Header1	Header1.1+	5bp sequence with no gaps and 2 lowercase bases
+O	Header2	Header2.1+ Header2.2 Header2.3+	5bp sequence with internal 1bp non-canonical gap
+O	Header3	Header3.1+ Header3.2 Header3.3+ Header3.4 Header3.5+ Header3.6	10bp sequence with internal 4bp and 1bp terminal canonical gap
+O	Header4	Header4.1 Header4.2+	15bp sequence with start 3bp canonical gap and 3 lowercase bases
+O	Header5	Header5.1+ Header5.2	15bp sequence with terminal 3bp canonical gap

docs/testFiles/random1.instructions.sak

@@ -0,0 +1,8 @@
+JOIN	Header1+	Header2+	5	newGap1	Scaffold1
+JOIN	Header4+	Header5+	5	newGap2	Scaffold2
+JOIN	Scaffold1+	Header3+	10	newGap3	FinalScaffold
+SPLIT	Header2.1	Header2.3	Scaffold3	Scaffold4
+EXCISE	Header3.3	3	newGap4
+INVERT	Header5.1
+REMOVE	Header1.1
+RESIZE	newGap2	10

docs/testFiles/random1.rvcp.sak

@@ -0,0 +1,2 @@
+RVCP	Header4
+RVCP	Header3

docs/testFiles/random2.gfa

@@ -0,0 +1,11 @@
+H	VN:Z:1.2
+S	11	ACCTT	LN:i:5	QL:Z:?@97?
+S	12	TCAAGG	LN:i:6	QL:Z:@6?84@
+S	13	CTTgaTT	LN:i:7	QL:Z:>=?@877
+L	11	+	12	-	4M
+L	12	-	13	+	5M
+L	11	+	13	+	3M
+J	11	+	13	-	5	SC:i:1
+J	13	-	12	+	3	SC:i:1
+P	14	11+;13-;12+	5,3
+P	15	11+,12-,13+	4M,5M

docs/testFiles/random2.noseq.gfa

@@ -0,0 +1,11 @@
+H	VN:Z:1.2
+S	11	*	LN:i:5	QL:Z:?@97?
+S	12	*	LN:i:6	QL:Z:@6?84@
+S	13	*	LN:i:7	QL:Z:>=?@877
+L	11	+	12	-	4M
+L	12	-	13	+	5M
+L	11	+	13	+	3M
+J	11	+	13	-	5	SC:i:1
+J	13	-	12	+	3	SC:i:1
+P	14	11+;13-;12+	5,3
+P	15	11+,12-,13+	4M,5M

docs/testFiles/random5.findovl.gfa

@@ -0,0 +1,8 @@
+H	VN:Z:1.2
+S	11	CCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCGCCATAAA	LN:i:55
+S	12	GATTTAAGAATATGTTAACGGAGGATTGCACGATCTTCTCTCCTCGTGAGAGAATTTATG	LN:i:60
+S	13	AAATCGCATAGCTATGTATTTTGCAGAGGTAGCGACATCTTGACGGGCACTTCACAGATAGTGGG	LN:i:65
+J	11	+	13	-	5	SC:i:1
+J	13	-	12	+	3	SC:i:1
+P	14	11+;13-;12+	5,3
+P	15	11+,12-,13+	6M,5M