Skip to content

Latest commit

 

History

History
113 lines (86 loc) · 5.74 KB

README.md

File metadata and controls

113 lines (86 loc) · 5.74 KB

install with bioconda Conda

LICENSE

strucVis : Display small RNA depth of coverage on a predicted RNA secondary structure

Copyright (C) 2016-2024 Michael J. Axtell

This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.

This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.

You should have received a copy of the GNU General Public License along with this program. If not, see http://www.gnu.org/licenses/.

AUTHOR Michael J. Axtell, Penn State University [email protected]

REQUIREMENTS

  • perl5 (available at /usr/bin/env perl)
  • samtools (installed in your PATH)
  • RNAfold (installed in your PATH)
  • ps2pdf (installed in your PATH .. this is part of the ghostscript package)

Install using conda

Linux, Intel-based Mac OSX

  1. Ensure conda is installed on your device.
  2. Set up channels to include bioconda, following instructions at https://bioconda.github.io
  3. conda create --name strucvis strucvis

Silicon-based Max OSX

Do steps 1 and 2 as above. Then:

conda create --name strucvis
conda activate strucvis
conda config --env --set subdir osx-64
conda install strucvis

USAGE

strucVis -b [bam] -g [genome] -c [Chr:start-stop] -s [strand 'plus' or 'minus'] -p [image_output] -n [Locus name]

INPUTS

    -b : path to sorted and indexed BAM alignment file of small RNAs

    -g : path to FASTA formatted reference genome. Must be indexed using
    samtools faidx.

    -c : Coordinates of interest in format Chr:start-stop.

    -s : Strand of interest. Either 'plus' or 'minus'.

    -p : Output pdf file name. Omit the .pdf suffix, it will be added for you.

    -n : Name of locus. Prints name in the pdf file and on the plain text
    alignments. If not provided, defaults to 'Unnamed Locus'

SWITCHES
    -x : Suppress the printing of detailed file information on the
    post-script file

    -v : Print the version and quit

    -h : Print help message and quit

OUTPUT

  • A pdf image showing the predicted RNA secondary structure with each nucleotide color-coded to represent the depth of sRNA alignments. strucVis_image
  • A plain-text file showing the predicted RNA secondary structure using dot-bracket notation, with sRNA alignments shown underneath.
Genome: ../EXP-2024-6/Arabidopsis_thalianaTAIR10.fa
Alignments: ../EXP-2024-6/SS/run1/merged_alignments.bam
Location: 4:11962937-11963045 minus
PDF file name: ShortStack_1716486683/strucVis/Cluster_1885.ps.pdf
Locus Name: Cluster_1885
UACUUUUUAUCUUCUUGAAAAUUUGUUACUAAUUUGGAAUGAAUUAGCUAAAUGGCUAAGCUAAUUUAUACCAAAUUAAUAGCAAAGUUUGAAGAACAUGAACAAUGUA
.....(((((.(((((.(((.(((((((.((((((((.(((((((((((.........))))))))))).)))))))).))))))).))).))))).)))))....... (-34.50)
....................AUUUGUUACUAAUUUGGAAUG.................................................................... len:21 al:47
....................AUUUGUUACUAAUUUGGAAUGAA.................................................................. len:23 al:1
....................AUUUGUUACUAAUUUGGAAUGAAU................................................................. len:24 al:2
....................AUUUGUUACUAAUUUGGAA...................................................................... len:19 al:1
....................AUUUGUUACUAAUUUGGAAUa.................................................................... len:21 al:1
....................AUUUGUUACUAAUU........................................................................... len:14 al:3
....................AUUUGUUACUAAUUUGGAAUu.................................................................... len:21 al:2
....................AUUUGUUACUAAUUUGuAAUG.................................................................... len:21 al:1
....................AUUUGUUACUAAUUUGGAAUGAu.................................................................. len:23 al:1
......................UUGUUACUAAUUUGGAAUG.................................................................... len:19 al:1
.......................................UGAAUUAGCUAA.......................................................... len:12 al:1
.................................................................UUAUACCAAAUUAAUAGC.......................... len:18 al:1
.................................................................UUAUACCAAAUUAAUAGCu......................... len:19 al:2
.................................................................UUAUACCAAAUUAAUAGCAu........................ len:20 al:1
.................................................................UUAUACCAAAUUAAUAGCAAAaUUU................... len:25 al:1
.................................................................UUAUACCAAAUUAAUAGCAAu....................... len:21 al:1
.................................................................UUAUACCAAAUUAAUAGCAAA....................... len:21 al:3
..................................................................UAUACCAAAUUAAUAGCAAAG...................... len:21 al:1
....................................................................UACCAAAUUAAUAGCAAAGUU.................... len:21 al:6
....................................................................UACCAAAUUAAUAGCAAAGU..................... len:20 al:1
......................................................................CCAAAUUAAUAGCAAAGUUUG.................. len:21 al:1