From 812b7fcbfb7994552b0b3e6c8ffc80d360ea0b7b Mon Sep 17 00:00:00 2001 From: ekiernan Date: Wed, 13 Nov 2024 13:30:52 -0500 Subject: [PATCH 1/7] testing h5ad fix --- pipelines/skylab/optimus/Optimus.wdl | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl index 58e65d42fc..789dde282e 100644 --- a/pipelines/skylab/optimus/Optimus.wdl +++ b/pipelines/skylab/optimus/Optimus.wdl @@ -91,7 +91,7 @@ workflow Optimus { String pytools_docker = "pytools:1.0.0-1661263730" String empty_drops_docker = "empty-drops:1.0.1-4.2" String star_docker = "star:1.0.1-2.7.11a-1692706072" - String warp_tools_docker_2_2_0 = "warp-tools:2.4.0" + String warp_tools_docker_2_2_0 = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" String star_merge_docker = "star-merge-npz:1.3.0" From 326b973b1e54c9adc777e2534dcb350f62da922d Mon Sep 17 00:00:00 2001 From: ekiernan Date: Wed, 13 Nov 2024 13:47:13 -0500 Subject: [PATCH 2/7] fixing docker --- pipelines/skylab/optimus/Optimus.wdl | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl index 789dde282e..5dd022323a 100644 --- a/pipelines/skylab/optimus/Optimus.wdl +++ b/pipelines/skylab/optimus/Optimus.wdl @@ -91,7 +91,7 @@ workflow Optimus { String pytools_docker = "pytools:1.0.0-1661263730" String empty_drops_docker = "empty-drops:1.0.1-4.2" String star_docker = "star:1.0.1-2.7.11a-1692706072" - String warp_tools_docker_2_2_0 = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" + String warp_tools_docker_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" String star_merge_docker = "star-merge-npz:1.3.0" From bf65955263c88523ac003044e453d25593bf98cb Mon Sep 17 00:00:00 2001 From: ekiernan Date: Wed, 20 Nov 2024 14:00:18 -0500 Subject: [PATCH 3/7] Changing additional warp-tools docker paths to test h5ad fix --- pipelines/skylab/atac/atac.wdl | 2 +- pipelines/skylab/slideseq/SlideSeq.wdl | 2 +- tasks/skylab/FastqProcessing.wdl | 2 +- tasks/skylab/H5adUtils.wdl | 4 ++-- 4 files changed, 5 insertions(+), 5 deletions(-) diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl index 521cb09dfd..e8d657579c 100644 --- a/pipelines/skylab/atac/atac.wdl +++ b/pipelines/skylab/atac/atac.wdl @@ -57,7 +57,7 @@ workflow ATAC { String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix # Docker image names - String warp_tools_2_2_0 = "warp-tools:2.2.0" + String warp_tools_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919" String samtools_docker = "samtools-dist-bwa:3.0.0" String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311" diff --git a/pipelines/skylab/slideseq/SlideSeq.wdl b/pipelines/skylab/slideseq/SlideSeq.wdl index 7c69d79232..b82fa383da 100644 --- a/pipelines/skylab/slideseq/SlideSeq.wdl +++ b/pipelines/skylab/slideseq/SlideSeq.wdl @@ -48,7 +48,7 @@ workflow SlideSeq { # docker images String pytools_docker = "pytools:1.0.0-1661263730" String picard_cloud_docker = "picard-cloud:2.26.10" - String warp_tools_docker_2_2_0 = "warp-tools:2.4.0" + String warp_tools_docker_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" String star_merge_docker = "star-merge-npz:1.3.0" String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf" diff --git a/tasks/skylab/FastqProcessing.wdl b/tasks/skylab/FastqProcessing.wdl index ea7363b738..79f7772850 100644 --- a/tasks/skylab/FastqProcessing.wdl +++ b/tasks/skylab/FastqProcessing.wdl @@ -138,7 +138,7 @@ task FastqProcessingSlidSeq { # Runtime attributes - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" Int cpu = 16 Int machine_mb = 40000 Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50 diff --git a/tasks/skylab/H5adUtils.wdl b/tasks/skylab/H5adUtils.wdl index af83a9e3f8..29c51f239f 100644 --- a/tasks/skylab/H5adUtils.wdl +++ b/tasks/skylab/H5adUtils.wdl @@ -531,7 +531,7 @@ task SingleNucleusSlideseqH5adOutput { task SingleNucleusSmartSeq2H5adOutput { input { #runtime values - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" Array[File] alignment_summary_metrics Array[File] dedup_metrics @@ -626,7 +626,7 @@ task AggregateSmartSeq2H5ad { Array[File] h5ad_input String batch_id String pipeline_version - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" + String docker = "warp-tools:lk-PD-2803-fix-refseq-h5ad" Int disk = 200 Int machine_mem_mb = 4000 Int cpu = 1 From 6e4cebbe9ca24792698583c161d821ed26f7d233 Mon Sep 17 00:00:00 2001 From: ekiernan Date: Fri, 22 Nov 2024 15:04:11 -0500 Subject: [PATCH 4/7] updated warp-tools dockers to tagged 2.5.0 and reverted snss2 to 2.3.0 --- pipelines/skylab/optimus/Optimus.wdl | 2 +- pipelines/skylab/slideseq/SlideSeq.wdl | 2 +- tasks/skylab/FastqProcessing.wdl | 2 +- tasks/skylab/H5adUtils.wdl | 4 ++-- 4 files changed, 5 insertions(+), 5 deletions(-) diff --git a/pipelines/skylab/optimus/Optimus.wdl b/pipelines/skylab/optimus/Optimus.wdl index b650a4bf9d..fc027f0ee0 100644 --- a/pipelines/skylab/optimus/Optimus.wdl +++ b/pipelines/skylab/optimus/Optimus.wdl @@ -91,7 +91,7 @@ workflow Optimus { String pytools_docker = "pytools:1.0.0-1661263730" String empty_drops_docker = "empty-drops:1.0.1-4.2" String star_docker = "star:1.0.1-2.7.11a-1692706072" - String warp_tools_docker_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" + String warp_tools_docker_2_2_0 = "warp-tools:2.5.0" String star_merge_docker = "star-merge-npz:1.3.0" String samtools_star = "samtools-star:1.0.0-1.11-2.7.11a-1731516196" diff --git a/pipelines/skylab/slideseq/SlideSeq.wdl b/pipelines/skylab/slideseq/SlideSeq.wdl index b82fa383da..e258436f8a 100644 --- a/pipelines/skylab/slideseq/SlideSeq.wdl +++ b/pipelines/skylab/slideseq/SlideSeq.wdl @@ -48,7 +48,7 @@ workflow SlideSeq { # docker images String pytools_docker = "pytools:1.0.0-1661263730" String picard_cloud_docker = "picard-cloud:2.26.10" - String warp_tools_docker_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" + String warp_tools_docker_2_2_0 = "warp-tools:2.5.0" String star_merge_docker = "star-merge-npz:1.3.0" String ubuntu_docker = "ubuntu_16_0_4@sha256:025124e2f1cf4d29149958f17270596bffe13fc6acca6252977c572dd5ba01bf" diff --git a/tasks/skylab/FastqProcessing.wdl b/tasks/skylab/FastqProcessing.wdl index 79f7772850..5263f53ef2 100644 --- a/tasks/skylab/FastqProcessing.wdl +++ b/tasks/skylab/FastqProcessing.wdl @@ -138,7 +138,7 @@ task FastqProcessingSlidSeq { # Runtime attributes - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.5.0" Int cpu = 16 Int machine_mb = 40000 Int disk = ceil(size(r1_fastq, "GiB")*3 + size(r2_fastq, "GiB")*3) + 50 diff --git a/tasks/skylab/H5adUtils.wdl b/tasks/skylab/H5adUtils.wdl index 29c51f239f..af83a9e3f8 100644 --- a/tasks/skylab/H5adUtils.wdl +++ b/tasks/skylab/H5adUtils.wdl @@ -531,7 +531,7 @@ task SingleNucleusSlideseqH5adOutput { task SingleNucleusSmartSeq2H5adOutput { input { #runtime values - String docker = "us.gcr.io/broad-gotc-prod/warp-tools:lk-PD-2803-fix-refseq-h5ad" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" Array[File] alignment_summary_metrics Array[File] dedup_metrics @@ -626,7 +626,7 @@ task AggregateSmartSeq2H5ad { Array[File] h5ad_input String batch_id String pipeline_version - String docker = "warp-tools:lk-PD-2803-fix-refseq-h5ad" + String docker = "us.gcr.io/broad-gotc-prod/warp-tools:2.3.0" Int disk = 200 Int machine_mem_mb = 4000 Int cpu = 1 From 484e0b978eaf951a27cf92cd66c2518b104c70c8 Mon Sep 17 00:00:00 2001 From: ekiernan Date: Fri, 22 Nov 2024 15:05:18 -0500 Subject: [PATCH 5/7] updated atac warp-tools docker to 2.5.0 --- pipelines/skylab/atac/atac.wdl | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl index e8d657579c..510f228f92 100644 --- a/pipelines/skylab/atac/atac.wdl +++ b/pipelines/skylab/atac/atac.wdl @@ -57,7 +57,7 @@ workflow ATAC { String docker_prefix = if cloud_provider == "gcp" then gcr_docker_prefix else acr_docker_prefix # Docker image names - String warp_tools_2_2_0 = "warp-tools:lk-PD-2803-fix-refseq-h5ad" + String warp_tools_2_2_0 = "warp-tools:2.5.0" String cutadapt_docker = "cutadapt:1.0.0-4.4-1686752919" String samtools_docker = "samtools-dist-bwa:3.0.0" String upstools_docker = "upstools:1.0.0-2023.03.03-1704300311" From 8a05284430faa7dfb4711c7eb41693885eb23132 Mon Sep 17 00:00:00 2001 From: ekiernan Date: Fri, 22 Nov 2024 15:34:42 -0500 Subject: [PATCH 6/7] changelog updates --- pipelines/skylab/atac/atac.changelog.md | 5 +++++ pipelines/skylab/atac/atac.wdl | 2 +- pipelines/skylab/multiome/Multiome.changelog.md | 3 ++- pipelines/skylab/optimus/Optimus.changelog.md | 3 ++- pipelines/skylab/paired_tag/PairedTag.changelog.md | 3 ++- pipelines/skylab/slideseq/SlideSeq.changelog.md | 1 + 6 files changed, 13 insertions(+), 4 deletions(-) diff --git a/pipelines/skylab/atac/atac.changelog.md b/pipelines/skylab/atac/atac.changelog.md index 5c2c0aea4b..578088a0d6 100644 --- a/pipelines/skylab/atac/atac.changelog.md +++ b/pipelines/skylab/atac/atac.changelog.md @@ -1,3 +1,8 @@ +# 2.5.3 +2024-11-22 (Date of Last Commit) + +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files; does not impact ATAC workflow + # 2.5.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/atac/atac.wdl b/pipelines/skylab/atac/atac.wdl index 510f228f92..c0c748c042 100644 --- a/pipelines/skylab/atac/atac.wdl +++ b/pipelines/skylab/atac/atac.wdl @@ -49,7 +49,7 @@ workflow ATAC { String adapter_seq_read3 = "TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG" } - String pipeline_version = "2.5.2" + String pipeline_version = "2.5.3" # Determine docker prefix based on cloud provider String gcr_docker_prefix = "us.gcr.io/broad-gotc-prod/" diff --git a/pipelines/skylab/multiome/Multiome.changelog.md b/pipelines/skylab/multiome/Multiome.changelog.md index 4a05f926be..b1577ed4be 100644 --- a/pipelines/skylab/multiome/Multiome.changelog.md +++ b/pipelines/skylab/multiome/Multiome.changelog.md @@ -1,7 +1,8 @@ # 5.9.2 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 5.9.1 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/optimus/Optimus.changelog.md b/pipelines/skylab/optimus/Optimus.changelog.md index d05e53bee5..9e7e385c8a 100644 --- a/pipelines/skylab/optimus/Optimus.changelog.md +++ b/pipelines/skylab/optimus/Optimus.changelog.md @@ -1,7 +1,8 @@ # 7.8.3 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 7.8.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/paired_tag/PairedTag.changelog.md b/pipelines/skylab/paired_tag/PairedTag.changelog.md index e411e0f679..3ada0c9188 100644 --- a/pipelines/skylab/paired_tag/PairedTag.changelog.md +++ b/pipelines/skylab/paired_tag/PairedTag.changelog.md @@ -1,7 +1,8 @@ # 1.8.3 -2024-11-15 (Date of Last Commit) +2024-11-22 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 1.8.2 2024-11-12 (Date of Last Commit) diff --git a/pipelines/skylab/slideseq/SlideSeq.changelog.md b/pipelines/skylab/slideseq/SlideSeq.changelog.md index 54c9fb6890..a40017660d 100644 --- a/pipelines/skylab/slideseq/SlideSeq.changelog.md +++ b/pipelines/skylab/slideseq/SlideSeq.changelog.md @@ -2,6 +2,7 @@ 2024-11-15 (Date of Last Commit) * Added bam validation in the StarSoloFastq task; this does not affect the outputs of the pipeline +* Updated the warp-tools docker; this update changes the way gene_names are identified when creating gene expression h5ad files # 3.4.5 2024-11-12 (Date of Last Commit) From 6f48a30a52d919c45d04b8e3e6172613c2c0864f Mon Sep 17 00:00:00 2001 From: GitHub Action Date: Fri, 22 Nov 2024 20:35:57 +0000 Subject: [PATCH 7/7] Updated pipeline_versions.txt with all pipeline version information --- pipeline_versions.txt | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/pipeline_versions.txt b/pipeline_versions.txt index 9964940111..d06921a88f 100644 --- a/pipeline_versions.txt +++ b/pipeline_versions.txt @@ -30,11 +30,11 @@ ExomeReprocessing 3.3.3 2024-11-04 BuildIndices 3.0.0 2023-12-06 scATAC 1.3.2 2023-08-03 snm3C 4.0.4 2024-08-06 -Multiome 5.9.2 2024-11-15 -PairedTag 1.8.3 2024-11-15 +Multiome 5.9.2 2024-11-22 +PairedTag 1.8.3 2024-11-22 MultiSampleSmartSeq2 2.2.22 2024-09-11 MultiSampleSmartSeq2SingleNucleus 2.0.5 2024-11-15 -Optimus 7.8.3 2024-11-15 -atac 2.5.2 2024-11-12 +Optimus 7.8.3 2024-11-22 +atac 2.5.3 2024-11-22 SmartSeq2SingleSample 5.1.21 2024-09-11 SlideSeq 3.4.6 2024-11-15