switch to BWA (for <=4bp mismatches)

[mbsimonovic]

# cat reads.fa
> TTTATTTCCACACTTCATGG, has a 3bp mismatch read on the same chromosome (- strand): TTTATTTCCACATATGATGG/TTTATTTCCACA**T*ATGG chr10:25378199-25378221
TTTATTTCCACACTTCATGG

wget -O chr10.fa.gz ftp://ftp.ensembl.org/pub/release-85/fasta/danio_rerio/dna/Danio_rerio.GRCz10.dna.chromosome.10.fa.gz
$ ./bwa

Program: bwa (alignment via Burrows-Wheeler transformation)
Version: 0.7.17-r1188
..
$ ./bwa index chr10.fa.gz
$ ./bwa aln -o 0 -n 4 -k 4 -N -l 20 chr10.fa.gz reads.txt > reads.sai
$ ./bwa samse -n 100000 chr10.fa.gz reads.sai reads.txt
                               ^^^^^^^ need to figure out this number so only 1-4bp mismatches are found