diff --git a/.gitignore b/.gitignore index f982169a0..5124c9ac7 100644 --- a/.gitignore +++ b/.gitignore @@ -6,5 +6,3 @@ results/ testing/ testing* *.pyc -tests/ -test/ diff --git a/modules/nf-core/adapterremoval/tests/main.nf.test b/modules/nf-core/adapterremoval/tests/main.nf.test new file mode 100644 index 000000000..91c07b7ee --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/main.nf.test @@ -0,0 +1,120 @@ +nextflow_process { + + name "Test Process ADAPTERREMOVAL" + script "../main.nf" + process "ADAPTERREMOVAL" + + tag "modules" + tag "modules_nfcore" + tag "adapterremoval" + + test("single-end - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true, collapse:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.singles_truncated, + process.out.settings, + process.out.versions).match() }, + ) + } + } + + test("paired-end - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false, collapse:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + + test("paired-end collapse - sarscov2 - [fastq]") { + + options "--collapse" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.collapsed, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + + test("paired-end adapterlist - sarscov2 - [fastq]") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false, collapse:false ], // meta map + [ file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) ] + ] + input[1] = file("https://github.com/nf-core/test-datasets/raw/modules/data/delete_me/adapterremoval/adapterremoval_adapterlist.txt", + checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.paired_truncated, + process.out.settings, + process.out.versions).match() }, + { assert process.out.discarded } + ) + } + + } + +} diff --git a/modules/nf-core/adapterremoval/tests/main.nf.test.snap b/modules/nf-core/adapterremoval/tests/main.nf.test.snap new file mode 100644 index 000000000..f890167a9 --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/main.nf.test.snap @@ -0,0 +1,124 @@ +{ + "single-end - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true, + "collapse": false + }, + "test.truncated.fastq.gz:md5,119d1b1a0a71ca6e080ff7c53ee0b690" + ] + ], + [ + [ + { + "id": "test", + "single_end": true, + "collapse": false + }, + "test.settings:md5,2fd3d5d703b63ba33a83021fccf25f77" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:36.429445996" + }, + "paired-end - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + "test.settings:md5,b8a451d3981b327f3fdb44f40ba2d6d1" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:42.88672676" + }, + "paired-end collapse - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.settings:md5,b8a451d3981b327f3fdb44f40ba2d6d1" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:49.299792876" + }, + "paired-end adapterlist - sarscov2 - [fastq]": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + [ + "test.pair1.truncated.fastq.gz:md5,e3da014fbb9b428e952c62e8f0fb6402", + "test.pair2.truncated.fastq.gz:md5,2ebae722295ea66d84075a3b042e2b42" + ] + ] + ], + [ + [ + { + "id": "test", + "single_end": false, + "collapse": false + }, + "test.settings:md5,36d47d9b40dbc178167d1ae0274d18f3" + ] + ], + [ + "versions.yml:md5,00bcc9f0b864b96eeee21bc11773ee67" + ] + ], + "timestamp": "2023-12-09T19:19:57.26567964" + } +} \ No newline at end of file diff --git a/modules/nf-core/adapterremoval/tests/tags.yml b/modules/nf-core/adapterremoval/tests/tags.yml new file mode 100644 index 000000000..d3375ec50 --- /dev/null +++ b/modules/nf-core/adapterremoval/tests/tags.yml @@ -0,0 +1,2 @@ +adapterremoval: + - "modules/nf-core/adapterremoval/**" diff --git a/modules/nf-core/angsd/gl/tests/config_gl_1.conf b/modules/nf-core/angsd/gl/tests/config_gl_1.conf new file mode 100644 index 000000000..f45e3a4a6 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_1.conf @@ -0,0 +1,5 @@ +process { + withName: ANGSD_GL { + ext.args = '-GL 1 -doGlf 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_2.conf b/modules/nf-core/angsd/gl/tests/config_gl_2.conf new file mode 100644 index 000000000..f54bd748e --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_2.conf @@ -0,0 +1,6 @@ +process { + withName: ANGSD_GL { + // -doMajorMinor is needed for -doGlf 2 + ext.args = '-GL 2 -doGlf 2 -doMajorMinor 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_3.conf b/modules/nf-core/angsd/gl/tests/config_gl_3.conf new file mode 100644 index 000000000..ccfd5dcaf --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_3.conf @@ -0,0 +1,6 @@ +process { + withName: ANGSD_GL { + // -doMajorMinor is needed for -doGlf 3 + ext.args = '-GL 3 -doGlf 3 -doMajorMinor 1' + } +} diff --git a/modules/nf-core/angsd/gl/tests/config_gl_4.conf b/modules/nf-core/angsd/gl/tests/config_gl_4.conf new file mode 100644 index 000000000..fc9622d57 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/config_gl_4.conf @@ -0,0 +1,5 @@ +process { + withName: ANGSD_GL { + ext.args = '-GL 4 -doGlf 4' + } +} diff --git a/modules/nf-core/angsd/gl/tests/main.nf.test b/modules/nf-core/angsd/gl/tests/main.nf.test new file mode 100644 index 000000000..412f46a53 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/main.nf.test @@ -0,0 +1,245 @@ +// nf-core modules test angsd/gl +nextflow_process { + + name "Test Process ANGSD_GL" + script "../main.nf" + process "ANGSD_GL" + + tag "modules" + tag "modules_nfcore" + tag "angsd" + tag "angsd/gl" + + test("angsd - gl_samtools - bam") { + + when { + config "./config_gl_1.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_gatk - bam") { + + when { + config "./config_gl_2.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_soapsnp - bam") { + + when { + config "./config_gl_3.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_syk - bam") { + + when { + config "./config_gl_4.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_samtools - bam - stub") { + + options "-stub" + + when { + config "./config_gl_1.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_gatk - bam - stub") { + + options "-stub" + + when { + config "./config_gl_2.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_soapsnp - bam - stub") { + + options "-stub" + + when { + config "./config_gl_3.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + + test("angsd - gl_syk - bam - stub") { + + options "-stub" + + when { + config "./config_gl_4.conf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_markduplicates_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'test_fa' ], + file(params.test_data['homo_sapiens']['genome']['genome_21_fasta'], checkIfExists: true) + ] + input[2] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/angsd/gl/tests/main.nf.test.snap b/modules/nf-core/angsd/gl/tests/main.nf.test.snap new file mode 100644 index 000000000..9128813e1 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/main.nf.test.snap @@ -0,0 +1,282 @@ +{ + "angsd - gl_samtools - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,b1cafc93095fae26e476e6e253a7615c" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,b1cafc93095fae26e476e6e253a7615c" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:23:37.916689" + }, + "angsd - gl_gatk - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:28.489425" + }, + "angsd - gl_samtools - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:04.586755" + }, + "angsd - gl_soapsnp - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,6d5bc2aa4b5276781960813c12552600" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,6d5bc2aa4b5276781960813c12552600" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:25:09.666904" + }, + "angsd - gl_syk - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:27:16.099902" + }, + "angsd - gl_syk - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,ce3a9b56a2692316f2bd632980c53a7c" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,ce3a9b56a2692316f2bd632980c53a7c" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:25:39.786421" + }, + "angsd - gl_soapsnp - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.glf.gz:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:26:52.996405" + }, + "angsd - gl_gatk - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.beagle.gz:md5,424369dc4c67227624cb39f3cc96eb58" + ] + ], + "1": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ], + "genotype_likelihood": [ + [ + { + "id": "test", + "single_end": false + }, + "test.beagle.gz:md5,424369dc4c67227624cb39f3cc96eb58" + ] + ], + "versions": [ + "versions.yml:md5,bb85b4e15894438271413bb5dab17675" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:23:58.730987" + } +} \ No newline at end of file diff --git a/modules/nf-core/angsd/gl/tests/tags.yml b/modules/nf-core/angsd/gl/tests/tags.yml new file mode 100644 index 000000000..137fda1c2 --- /dev/null +++ b/modules/nf-core/angsd/gl/tests/tags.yml @@ -0,0 +1,2 @@ +angsd/gl: + - "modules/nf-core/angsd/gl/**" diff --git a/modules/nf-core/bedtools/coverage/tests/main.nf.test b/modules/nf-core/bedtools/coverage/tests/main.nf.test new file mode 100644 index 000000000..b9db30425 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + name "Test Process BEDTOOLS_COVERAGE" + script "../main.nf" + process "BEDTOOLS_COVERAGE" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/coverage" + + test("sarscov2") { + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - fai") { + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true) + ] + input[1] = file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap b/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap new file mode 100644 index 000000000..22f575389 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/main.nf.test.snap @@ -0,0 +1,64 @@ +{ + "sarscov2": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "1": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "versions": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ] + } + ], + "timestamp": "2023-12-05T17:37:06.311531" + }, + "sarscov2 - fai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "1": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ], + "bed": [ + [ + { + "id": "test", + "single_end": false + }, + "test.coverage.bed:md5,3d7e917f97bcb728510b614aa117193b" + ] + ], + "versions": [ + "versions.yml:md5,dcba2206f237e759331f671446bd5039" + ] + } + ], + "timestamp": "2023-12-05T17:37:14.228196" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/coverage/tests/nextflow.config b/modules/nf-core/bedtools/coverage/tests/nextflow.config new file mode 100644 index 000000000..ea1db46e2 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: BEDTOOLS_COVERAGE { + ext.prefix = { "${meta.id}.coverage" } + } + +} diff --git a/modules/nf-core/bedtools/coverage/tests/tags.yml b/modules/nf-core/bedtools/coverage/tests/tags.yml new file mode 100644 index 000000000..e9764bf01 --- /dev/null +++ b/modules/nf-core/bedtools/coverage/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/coverage: + - "modules/nf-core/bedtools/coverage/**" diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config new file mode 100644 index 000000000..fdc1c59dd --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/large_index.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_BUILD { + ext.args = '--large-index' + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test new file mode 100644 index 000000000..a478d17b5 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test @@ -0,0 +1,561 @@ +nextflow_process { + + name "Test Process BOWTIE2_ALIGN" + script "../main.nf" + process "BOWTIE2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/align" + + test("sarscov2 - fastq, index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam") { + + config "./sam.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, false - sam2") { + + config "./sam2.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], large_index, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, false, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_2_fastq_gz'], checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = false //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, true, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.test_data['sarscov2']['illumina']['test_1_fastq_gz'], checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = true //save_unaligned + input[3] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.aligned[0][1]).name, + file(process.out.log[0][1]).name, + file(process.out.fastq[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap new file mode 100644 index 000000000..883dc7ecb --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap @@ -0,0 +1,263 @@ +{ + "sarscov2 - fastq, index, false, false - sam2": { + "content": [ + [ + "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAA12.922000 K (92.984097%)", + "single end (151 cycles)" ] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end") } + ) + } + } + + test("test_fastp_single_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_single_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_single_end_stub") } + ) + } + } + + test("test_fastp_paired_end") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end") } + ) + } + } + + test("test_fastp_paired_end-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end-stub") } + ) + } + } + + test("fastp test_fastp_interleaved") { + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "paired end (151 cycles + 151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 198"] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("fastp test_fastp_interleaved_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved") } + ) + } + } + + test("fastp test_fastp_interleaved-stub") { + + options '-stub' + + config './nextflow.config' + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { file(it[1]).getName() } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_interleaved-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_interleaved-stub") } + ) + } + } + + test("test_fastp_single_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:12.922000 K (92.984097%)", + "single end (151 cycles)"] + def log_text = [ "Q20 bases: 12922(92.9841%)", + "reads passed filter: 99" ] + def read_lines = [ "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1)).linesGzip.contains(read_line) } + } + }, + { failed_read_lines.each { failed_read_line -> + { assert path(process.out.reads_fail.get(0).get(1)).linesGzip.contains(failed_read_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { assert snapshot(process.out.json).match("test_fastp_single_end_trim_fail_json") }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_single_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_trim_fail") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = true + save_merged = false + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "Q20 bases:25.719000 K (93.033098%)", + "The input has little adapter percentage (~0.000000%), probably it's trimmed before."] + def log_text = [ "No adapter detected for read1", + "Q30 bases: 12281(88.3716%)"] + def json_text = ['"passed_filter_reads": 198'] + def read1_lines = ["@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { failed_read2_lines.each { failed_read2_line -> + { assert path(process.out.reads_fail.get(0).get(1).get(1)).linesGzip.contains(failed_read2_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_trim_fail") } + ) + } + } + + test("test_fastp_paired_end_merged") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683'] + def read1_lines = [ "@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged") } + ) + } + } + + test("test_fastp_paired_end_merged-stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = [] + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + assertAll( + { assert process.success }, + { + assert snapshot( + ( + [process.out.reads[0][0].toString()] + // meta + process.out.reads.collect { it[1].collect { item -> file(item).getName() } } + + process.out.json.collect { file(it[1]).getName() } + + process.out.html.collect { file(it[1]).getName() } + + process.out.log.collect { file(it[1]).getName() } + + process.out.reads_fail.collect { file(it[1]).getName() } + + process.out.reads_merged.collect { file(it[1]).getName() } + ).sort() + ).match("test_fastp_paired_end_merged-for_stub_match") + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_stub") } + ) + } + } + + test("test_fastp_paired_end_merged_adapterlist") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + adapter_fasta = Channel.of([ file(params.modules_testdata_base_path + 'delete_me/fastp/adapters.fasta', checkIfExists: true) ]) + save_trimmed_fail = false + save_merged = true + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + input[1] = adapter_fasta + input[2] = save_trimmed_fail + input[3] = save_merged + """ + } + } + + then { + def html_text = [ "
"] + def log_text = [ "Merged and filtered:", + "total reads: 75", + "total bases: 13683"] + def json_text = ['"merged_and_filtered": {', '"total_reads": 75', '"total_bases": 13683',"--adapter_fasta"] + def read1_lines = ["@ERR5069949.1066259 NS500628:121:HK3MMAFX2:1:11312:18369:8333/1", + "CCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTC", + "AAAAAEAEEAEEEEEEEEEEEEEEEEAEEEEAEEEEEEEEAEEEEEEEEEEEEEEEEE/EAEEEEEE/6EEEEEEEEEEAEEAEEE/EE/AEEAEEEEEAEEEA/EEAAEAE + { assert path(process.out.reads.get(0).get(1).get(0)).linesGzip.contains(read1_line) } + } + }, + { read2_lines.each { read2_line -> + { assert path(process.out.reads.get(0).get(1).get(1)).linesGzip.contains(read2_line) } + } + }, + { read_merged_lines.each { read_merged_line -> + { assert path(process.out.reads_merged.get(0).get(1)).linesGzip.contains(read_merged_line) } + } + }, + { html_text.each { html_part -> + { assert path(process.out.html.get(0).get(1)).getText().contains(html_part) } + } + }, + { json_text.each { json_part -> + { assert path(process.out.json.get(0).get(1)).getText().contains(json_part) } + } + }, + { log_text.each { log_part -> + { assert path(process.out.log.get(0).get(1)).getText().contains(log_part) } + } + }, + { assert snapshot(process.out.versions).match("versions_paired_end_merged_adapterlist") } + ) + } + } +} diff --git a/modules/nf-core/fastp/tests/main.nf.test.snap b/modules/nf-core/fastp/tests/main.nf.test.snap new file mode 100644 index 000000000..b4c0e1dd8 --- /dev/null +++ b/modules/nf-core/fastp/tests/main.nf.test.snap @@ -0,0 +1,330 @@ +{ + "fastp test_fastp_interleaved_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,168f516f7bd4b7b6c32da7cba87299a4" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.123035" + }, + "test_fastp_paired_end_merged-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:10:13.467574" + }, + "versions_interleaved": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:24.615634793" + }, + "test_fastp_single_end_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,c852d7a6dba5819e4ac8d9673bedcacc" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.223817" + }, + "versions_paired_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:42.333545689" + }, + "test_fastp_paired_end_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:06.431833729" + }, + "test_fastp_interleaved-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:03:37.827323085" + }, + "test_fastp_paired_end_merged_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "test.merged.fastq.gz", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:08:44.496251446" + }, + "versions_single_end_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:27.354051299" + }, + "versions_interleaved-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:46.535528418" + }, + "versions_single_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:03.724591407" + }, + "test_fastp_paired_end-for_stub_match": { + "content": [ + [ + [ + "test_1.fastp.fastq.gz", + "test_2.fastp.fastq.gz" + ], + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=false}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:07:15.398827" + }, + "versions_paired_end-stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:56:06.50017282" + }, + "versions_single_end": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:55:07.67921647" + }, + "versions_paired_end_merged_stub": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:47.350653154" + }, + "test_fastp_interleaved-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:06.127974" + }, + "versions_paired_end_trim_fail": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:18.140484878" + }, + "test_fastp_single_end-for_stub_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:06:00.244202" + }, + "test_fastp_single_end-_match": { + "content": [ + [ + "test.fastp.fastq.gz", + "test.fastp.html", + "test.fastp.json", + "test.fastp.log", + "{id=test, single_end=true}" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:57:30.791982648" + }, + "versions_paired_end_merged_adapterlist": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T12:05:37.845370554" + }, + "versions_paired_end_merged": { + "content": [ + [ + "versions.yml:md5,48ffc994212fb1fc9f83a74fa69c9f02" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-01T11:59:32.860543858" + }, + "test_fastp_single_end_trim_fail_json": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastp.json:md5,9a7ee180f000e8d00c7fb67f06293eb5" + ] + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-01-17T18:08:41.942317" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastp/tests/nextflow.config b/modules/nf-core/fastp/tests/nextflow.config new file mode 100644 index 000000000..0f7849ad9 --- /dev/null +++ b/modules/nf-core/fastp/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + + withName: FASTP { + ext.args = "--interleaved_in" + } +} diff --git a/modules/nf-core/fastp/tests/tags.yml b/modules/nf-core/fastp/tests/tags.yml new file mode 100644 index 000000000..c1afcce75 --- /dev/null +++ b/modules/nf-core/fastp/tests/tags.yml @@ -0,0 +1,2 @@ +fastp: + - modules/nf-core/fastp/** diff --git a/modules/nf-core/freebayes/tests/main.nf.test b/modules/nf-core/freebayes/tests/main.nf.test new file mode 100644 index 000000000..bee25a8e7 --- /dev/null +++ b/modules/nf-core/freebayes/tests/main.nf.test @@ -0,0 +1,179 @@ +nextflow_process { + + name "Test Process FREEBAYES" + script "../main.nf" + process "FREEBAYES" + + tag "modules" + tag "modules_nfcore" + tag "freebayes" + + test("sarscov2 - [ bam, bai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [], + [] + ] + input[1] = [ [ id: 'test_fasta' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'test_fai' ], file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains('MT192765.1\t10214\t.\tATTTAC\tATTAC\t29.8242') }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ bam, bai, bed ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [], + file(params.test_data['sarscov2']['genome']['test_bed'], checkIfExists: true), + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['sarscov2']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ cram, crai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [], + [], + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t459.724") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ bam, bai, bam, bai ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t670.615") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } + + test("sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test2_paired_end_sorted_cram_crai'], checkIfExists: true), + file(params.test_data['homo_sapiens']['genome']['genome_bed'], checkIfExists: true), + ] + input[1] = [ [ id: 'fasta' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id: 'fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [], [] ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Output VCF includes a timestamp, so snapshot not consistent past a day. + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("test.vcf.gz") }, + { assert path(process.out.vcf.get(0).get(1)).linesGzip.toString().contains("chr22\t1982\t.\tA\tG\t670.615") }, + { assert snapshot(process.out.versions).match() }, + ) + } + + } +} diff --git a/modules/nf-core/freebayes/tests/main.nf.test.snap b/modules/nf-core/freebayes/tests/main.nf.test.snap new file mode 100644 index 000000000..9760a680e --- /dev/null +++ b/modules/nf-core/freebayes/tests/main.nf.test.snap @@ -0,0 +1,48 @@ +{ + "sarscov2 - [ cram, crai, cram, crai, bed ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:20:01.263906" + }, + "sarscov2 - [ bam, bai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:37.06375" + }, + "test.vcf.gz": { + "content": [ + "test.vcf.gz" + ], + "timestamp": "2023-12-13T12:19:37.050165" + }, + "sarscov2 - [ cram, crai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:48.797103" + }, + "sarscov2 - [ bam, bai, bed ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:43.147912" + }, + "sarscov2 - [ bam, bai, bam, bai ] - fasta - fai": { + "content": [ + [ + "versions.yml:md5,4d24a735eabf2f037ab935511a2bc99c" + ] + ], + "timestamp": "2023-12-13T12:19:55.186773" + } +} \ No newline at end of file diff --git a/modules/nf-core/freebayes/tests/tags.yml b/modules/nf-core/freebayes/tests/tags.yml new file mode 100644 index 000000000..5563fb326 --- /dev/null +++ b/modules/nf-core/freebayes/tests/tags.yml @@ -0,0 +1,2 @@ +freebayes: + - "modules/nf-core/freebayes/**" diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test new file mode 100644 index 000000000..a124bff53 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test @@ -0,0 +1,142 @@ +// nf-core modules test gatk4/haplotypecaller +nextflow_process { + + name "Test Process GATK4_HAPLOTYPECALLER" + script "../main.nf" + process "GATK4_HAPLOTYPECALLER" + + tag "modules" + tag "modules_nfcore" + tag "gatk4" + tag "gatk4/haplotypecaller" + + test("homo_sapiens - [bam, bai] - fasta - fai - dict") { + + when { + process { + """ + input[0] = [ + [ id:'test_bam' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_bam_bai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_bam_input") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_bam_input") }, + ) + } + + } + + test("homo_sapiens - [cram, crai] - fasta - fai - dict") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [], [] ] + input[5] = [ [], [] ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_input") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_input") }, + ) + } + + } + + test("homo_sapiens - [cram, crai] - fasta - fai - dict - sites - sites_tbi") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram_sites' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + [] + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [ id:'test_sites' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz'], checkIfExists: true) ] + input[5] = [ [ id:'test_sites_tbi' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz_tbi'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_input_with_sites") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_input_with_sites") }, + ) + } + + } + + test("homo_sapiens - [cram, crai, dragstr_model] - fasta - fai - dict - sites - sites_tbi") { + + when { + process { + """ + input[0] = [ + [ id:'test_cram_sites_dragstr' ], // meta map + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram'], checkIfExists: true), + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_cram_crai'], checkIfExists: true), + [], + file(params.test_data['homo_sapiens']['illumina']['test_paired_end_sorted_dragstrmodel'], checkIfExists: true) + ] + input[1] = [ [ id:'test_fa' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta'], checkIfExists: true) ] + input[2] = [ [ id:'test_fai' ], file(params.test_data['homo_sapiens']['genome']['genome_fasta_fai'], checkIfExists: true) ] + input[3] = [ [ id:'test_dict' ], file(params.test_data['homo_sapiens']['genome']['genome_dict'], checkIfExists: true) ] + input[4] = [ [ id:'test_sites' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz'], checkIfExists: true) ] + input[5] = [ [ id:'test_sites_tbi' ], file(params.test_data['homo_sapiens']['genome']['dbsnp_146_hg38_vcf_gz_tbi'], checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + // { assert snapshot(process.out).match() }, // Unstable hashes + { assert snapshot(file(process.out.vcf.get(0).get(1)).name).match("gatk_hc_vcf_cram_dragstr_input_with_sites") }, + { assert snapshot(file(process.out.tbi.get(0).get(1)).name).match("gatk_hc_vcf_tbi_cram_dragstr_input_with_sites") }, + ) + } + + } + +} diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap new file mode 100644 index 000000000..375025ee3 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/main.nf.test.snap @@ -0,0 +1,82 @@ +{ + "gatk_hc_vcf_cram_dragstr_input_with_sites": { + "content": [ + "test_cram_sites_dragstr.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:45.142682" + }, + "gatk_hc_vcf_bam_input": { + "content": [ + "test_bam.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:19.203837" + }, + "gatk_hc_vcf_cram_input": { + "content": [ + "test_cram.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:48.434615" + }, + "gatk_hc_vcf_cram_input_with_sites": { + "content": [ + "test_cram_sites.vcf.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:17.147745" + }, + "gatk_hc_vcf_tbi_bam_input": { + "content": [ + "test_bam.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:19.23048" + }, + "gatk_hc_vcf_tbi_cram_input": { + "content": [ + "test_cram.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:23:48.45958" + }, + "gatk_hc_vcf_tbi_cram_dragstr_input_with_sites": { + "content": [ + "test_cram_sites_dragstr.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:45.154818" + }, + "gatk_hc_vcf_tbi_cram_input_with_sites": { + "content": [ + "test_cram_sites.vcf.gz.tbi" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-20T13:24:17.158138" + } +} \ No newline at end of file diff --git a/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml b/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml new file mode 100644 index 000000000..d05bb6554 --- /dev/null +++ b/modules/nf-core/gatk4/haplotypecaller/tests/tags.yml @@ -0,0 +1,2 @@ +gatk4/haplotypecaller: + - "modules/nf-core/gatk4/haplotypecaller/**" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test new file mode 100644 index 000000000..6406008ef --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -0,0 +1,36 @@ +nextflow_process { + + name "Test Process GUNZIP" + script "../main.nf" + process "GUNZIP" + tag "gunzip" + tag "modules_nfcore" + tag "modules" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap new file mode 100644 index 000000000..720fd9ff4 --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -0,0 +1,31 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "timestamp": "2023-10-17T15:35:37.690477896" + } +} \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml new file mode 100644 index 000000000..fd3f69154 --- /dev/null +++ b/modules/nf-core/gunzip/tests/tags.yml @@ -0,0 +1,2 @@ +gunzip: + - modules/nf-core/gunzip/** diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test b/modules/nf-core/picard/markduplicates/tests/main.nf.test new file mode 100644 index 000000000..c5a29b4bd --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test @@ -0,0 +1,104 @@ +nextflow_process { + + name "Test Process PICARD_MARKDUPLICATES" + script "../main.nf" + process "PICARD_MARKDUPLICATES" + config "./nextflow.config" + tag "modules" + tag "modules_nfcore" + tag "picard" + tag "picard/markduplicates" + + test("sarscov2 [unsorted bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("unsorted_bam_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("unsorted_bam_metrics") }, + { assert snapshot(process.out.versions).match("unsorted_bam_versions") } + ) + } + } + + test("sarscov2 [sorted bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("sorted_bam_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("sorted_bam_metrics") }, + { assert snapshot(process.out.versions).match("sorted_bam_versions") } + ) + } + } + + test("homo_sapiens [cram]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + input[2] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.bam[0][1]).name).match("cram_name") }, + { assert snapshot(path(process.out.metrics.get(0).get(1)).readLines()[0..2]).match("cram_metrics") }, + { assert snapshot(process.out.versions).match("cram_versions") } + ) + } + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap new file mode 100644 index 000000000..31c9130dc --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/main.nf.test.snap @@ -0,0 +1,74 @@ +{ + "sorted_bam_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:26:45.092349" + }, + "unsorted_bam_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:26:28.100755" + }, + "cram_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.cram --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:27:03.253071" + }, + "sorted_bam_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.sorted.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:26:45.086503" + }, + "cram_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:27:03.241617" + }, + "cram_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:27:03.26989" + }, + "unsorted_bam_versions": { + "content": [ + [ + "versions.yml:md5,b699af51b1956f3810f8a7c066e0ab17" + ] + ], + "timestamp": "2024-01-19T10:26:28.159071" + }, + "unsorted_bam_metrics": { + "content": [ + [ + "## htsjdk.samtools.metrics.StringHeader", + "# MarkDuplicates --INPUT test.paired_end.bam --OUTPUT test.marked.bam --METRICS_FILE test.marked.MarkDuplicates.metrics.txt --ASSUME_SORT_ORDER queryname --REFERENCE_SEQUENCE genome.fasta --MAX_SEQUENCES_FOR_DISK_READ_ENDS_MAP 50000 --MAX_FILE_HANDLES_FOR_READ_ENDS_MAP 8000 --SORTING_COLLECTION_SIZE_RATIO 0.25 --TAG_DUPLICATE_SET_MEMBERS false --REMOVE_SEQUENCING_DUPLICATES false --TAGGING_POLICY DontTag --CLEAR_DT true --DUPLEX_UMI false --FLOW_MODE false --FLOW_QUALITY_SUM_STRATEGY false --USE_END_IN_UNPAIRED_READS false --USE_UNPAIRED_CLIPPED_END false --UNPAIRED_END_UNCERTAINTY 0 --FLOW_SKIP_FIRST_N_FLOWS 0 --FLOW_Q_IS_KNOWN_END false --FLOW_EFFECTIVE_QUALITY_THRESHOLD 15 --ADD_PG_TAG_TO_READS true --REMOVE_DUPLICATES false --ASSUME_SORTED false --DUPLICATE_SCORING_STRATEGY SUM_OF_BASE_QUALITIES --PROGRAM_RECORD_ID MarkDuplicates --PROGRAM_GROUP_NAME MarkDuplicates --READ_NAME_REGEX --OPTICAL_DUPLICATE_PIXEL_DISTANCE 100 --MAX_OPTICAL_DUPLICATE_SET_SIZE 300000 --VERBOSITY INFO --QUIET false --VALIDATION_STRINGENCY STRICT --COMPRESSION_LEVEL 5 --MAX_RECORDS_IN_RAM 500000 --CREATE_INDEX false --CREATE_MD5_FILE false --help false --version false --showHidden false --USE_JDK_DEFLATER false --USE_JDK_INFLATER false", + "## htsjdk.samtools.metrics.StringHeader" + ] + ], + "timestamp": "2024-01-19T10:26:28.143979" + }, + "sorted_bam_name": { + "content": [ + "test.marked.bam" + ], + "timestamp": "2024-01-19T10:26:45.080116" + } +} \ No newline at end of file diff --git a/modules/nf-core/picard/markduplicates/tests/nextflow.config b/modules/nf-core/picard/markduplicates/tests/nextflow.config new file mode 100644 index 000000000..02818dd6e --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/nextflow.config @@ -0,0 +1,6 @@ +process { + withName: PICARD_MARKDUPLICATES { + ext.prefix = { "${meta.id}.marked" } + ext.args = '--ASSUME_SORT_ORDER queryname' + } +} diff --git a/modules/nf-core/picard/markduplicates/tests/tags.yml b/modules/nf-core/picard/markduplicates/tests/tags.yml new file mode 100644 index 000000000..4f213d620 --- /dev/null +++ b/modules/nf-core/picard/markduplicates/tests/tags.yml @@ -0,0 +1,2 @@ +picard/markduplicates: + - modules/nf-core/picard/markduplicates/** diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test b/modules/nf-core/preseq/lcextrap/tests/main.nf.test new file mode 100644 index 000000000..aa12bc1ab --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test @@ -0,0 +1,54 @@ +nextflow_process { + + name "Test Process PRESEQ_LCEXTRAP" + script "../main.nf" + process "PRESEQ_LCEXTRAP" + tag "modules" + tag "modules_nfcore" + tag "preseq" + tag "preseq/lcextrap" + + test("sarscov2 - single_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'delete_me/preseq/SRR1003759_5M_subset.mr', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log[0][1]).name).match("single_end - log") }, + { assert snapshot(process.out.lc_extrap).match("single_end - lc_extrap") }, + { assert snapshot(process.out.versions).match("single_end - versions") } + ) + } + } + + test("sarscov2 - paired_end") { + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'delete_me/preseq/SRR1003759_5M_subset.mr', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(file(process.out.log[0][1]).name).match("paired_end - log") }, + { assert snapshot(process.out.lc_extrap).match("paired_end - lc_extrap") }, + { assert snapshot(process.out.versions).match("paired_end - versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap b/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap new file mode 100644 index 000000000..c59dea7fe --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/main.nf.test.snap @@ -0,0 +1,58 @@ +{ + "single_end - lc_extrap": { + "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.lc_extrap.txt:md5,1fa5cdd601079329618f61660bee00de" + ] + ] + ], + "timestamp": "2023-11-23T17:20:40.735535" + }, + "paired_end - log": { + "content": [ + "test.command.log" + ], + "timestamp": "2023-11-23T17:20:51.981746" + }, + "single_end - versions": { + "content": [ + [ + "versions.yml:md5,9a62ff1c212c53573808ccd2137b8922" + ] + ], + "timestamp": "2023-11-23T17:20:40.74601" + }, + "paired_end - versions": { + "content": [ + [ + "versions.yml:md5,9a62ff1c212c53573808ccd2137b8922" + ] + ], + "timestamp": "2023-11-23T17:20:52.02843" + }, + "single_end - log": { + "content": [ + "test.command.log" + ], + "timestamp": "2023-11-23T17:20:40.72985" + }, + "paired_end - lc_extrap": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.lc_extrap.txt:md5,10e5ea860e87fb6f5dc10f4f20c62040" + ] + ] + ], + "timestamp": "2023-11-23T17:20:51.998533" + } +} \ No newline at end of file diff --git a/modules/nf-core/preseq/lcextrap/tests/tags.yml b/modules/nf-core/preseq/lcextrap/tests/tags.yml new file mode 100644 index 000000000..b9e25ea71 --- /dev/null +++ b/modules/nf-core/preseq/lcextrap/tests/tags.yml @@ -0,0 +1,2 @@ +preseq/lcextrap: + - modules/nf-core/preseq/lcextrap/** diff --git a/modules/nf-core/qualimap/bamqc/tests/main.nf.test b/modules/nf-core/qualimap/bamqc/tests/main.nf.test new file mode 100644 index 000000000..ba2260cae --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/main.nf.test @@ -0,0 +1,39 @@ +nextflow_process { + + name "Test Process QUALIMAP_BAMQC" + script "../main.nf" + process "QUALIMAP_BAMQC" + tag "modules" + tag "modules_nfcore" + tag "qualimap" + tag "qualimap/bamqc" + + test("homo_sapiens [bam]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + gff = [] + + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + input[1] = gff + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert path("${process.out.results[0][1]}/qualimapReport.html").exists() }, + { assert snapshot(path("${process.out.results[0][1]}/genome_results.txt")).match("genome_results") }, + { assert snapshot(process.out.versions).match("versions") } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap b/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap new file mode 100644 index 000000000..25148df2b --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/main.nf.test.snap @@ -0,0 +1,16 @@ +{ + "genome_results": { + "content": [ + "genome_results.txt:md5,45103d63ba82df2b905eb04819c32dd3" + ], + "timestamp": "2024-01-19T12:05:00.122103" + }, + "versions": { + "content": [ + [ + "versions.yml:md5,9024d7d0a189d8be1485249ae591b907" + ] + ], + "timestamp": "2024-01-19T12:05:00.131485" + } +} diff --git a/modules/nf-core/qualimap/bamqc/tests/tags.yml b/modules/nf-core/qualimap/bamqc/tests/tags.yml new file mode 100644 index 000000000..b2b5eb6fc --- /dev/null +++ b/modules/nf-core/qualimap/bamqc/tests/tags.yml @@ -0,0 +1,2 @@ +qualimap/bamqc: + - modules/nf-core/qualimap/bamqc/** diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test b/modules/nf-core/samtools/fastq/tests/main.nf.test new file mode 100644 index 000000000..8280c5449 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test @@ -0,0 +1,70 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FASTQ" + script "../main.nf" + process "SAMTOOLS_FASTQ" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fastq" + + test("sarscov2 - bam, false") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = false + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.fastq[0][1].collect { path(it).linesGzip[0..6] }, + process.out.interleaved, + file(process.out.singleton[0][1]).name, + file(process.out.other[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - bam, true") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true) + ] + input[1] = true + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.fastq, + path(process.out.interleaved[0][1]).readLines()[0..6], + process.out.singleton, + file(process.out.other[0][1]).name, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/fastq/tests/main.nf.test.snap b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap new file mode 100644 index 000000000..70fd21790 --- /dev/null +++ b/modules/nf-core/samtools/fastq/tests/main.nf.test.snap @@ -0,0 +1,59 @@ +{ + "sarscov2 - bam, true": { + "content": [ + [ + + ], + [ + "@ERR5069949.2151832/1", + "TCATAAACCAAAGCACTCACAGTGTCAACAATTTCAGCAGGACAACGCCGACAAGTTCCGAGGAACATGTCTGGACCTATAGTTTTCATAAGTCTACACACTGAATTGAAATATTCTGGTTCTAGTGTGCCCTTAGTTAGCAATGTGCGT", + "+", + "AAAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAEEEEE