add: verbose testing

- nucleotide-count
- rotational-cipher
- difference-of-squares
- secret-handshake
- darts

exercises/practice/darts/runtests.jl

@@ -2,55 +2,56 @@ using Test
 
 include("darts.jl")
 
-@testset "Missed target" begin
-    @test score(-9, 9) == 0
-end
+@testset verbose = true "Darts" begin
+    @testset "Missed target" begin
+        @test score(-9, 9) == 0
+    end
 
-@testset "On the outer circle" begin
-    @test score(0, 10) == 1
-end
+    @testset "On the outer circle" begin
+        @test score(0, 10) == 1
+    end
 
-@testset "On the middle circle" begin
-    @test score(-5, 0) == 5
-end
+    @testset "On the middle circle" begin
+        @test score(-5, 0) == 5
+    end
 
-@testset "On the inner circle" begin
-    @test score(0, -1) == 10
-end
+    @testset "On the inner circle" begin
+        @test score(0, -1) == 10
+    end
 
-@testset "Exactly on centre" begin
-    @test score(0, 0) == 10
-end
+    @testset "Exactly on centre" begin
+        @test score(0, 0) == 10
+    end
 
-@testset "Near the centre" begin
-    @test score(-0.1, -0.1) == 10
-end
+    @testset "Near the centre" begin
+        @test score(-0.1, -0.1) == 10
+    end
 
-@testset "Just within the inner circle" begin
-    @test score(0.7, 0.7) == 10
-end
+    @testset "Just within the inner circle" begin
+        @test score(0.7, 0.7) == 10
+    end
 
-@testset "Just outside the inner circle" begin
-    @test score(0.8, -0.8) == 5
-end
+    @testset "Just outside the inner circle" begin
+        @test score(0.8, -0.8) == 5
+    end
 
-@testset "Just within the middle circle" begin
-    @test score(-3.5, 3.5) == 5
-end
+    @testset "Just within the middle circle" begin
+        @test score(-3.5, 3.5) == 5
+    end
 
-@testset "Just outside the middle circle" begin
-    @test score(-3.6, -3.6) == 1
-end
+    @testset "Just outside the middle circle" begin
+        @test score(-3.6, -3.6) == 1
+    end
 
-@testset "Just within the outer circle" begin
-    @test score(-7.0, 7.0) == 1
-end
+    @testset "Just within the outer circle" begin
+        @test score(-7.0, 7.0) == 1
+    end
 
-@testset "Just outside the outer circle" begin
-    @test score(7.1, -7.1) == 0
-end
+    @testset "Just outside the outer circle" begin
+        @test score(7.1, -7.1) == 0
+    end
 
-@testset "Asymmetric position between the inner and middle circles" begin
-    @test score(0.5, -4) == 5
+    @testset "Asymmetric position between the inner and middle circles" begin
+        @test score(0.5, -4) == 5
+    end
 end
-

exercises/practice/difference-of-squares/runtests.jl

@@ -2,24 +2,26 @@ using Test
 
 include("difference-of-squares.jl")
 
-@testset "Square the sum of the numbers up to the given number" begin
-    @test square_of_sum(1)::Integer == 1
-    @test square_of_sum(5)::Integer == 225
-    @test square_of_sum(10)::Integer == 3025
-    @test square_of_sum(100)::Integer == 25502500
-end
+@testset verbose = true "Difference of Squares" begin
+    @testset "Square the sum of the numbers up to the given number" begin
+        @test square_of_sum(1)::Integer == 1
+        @test square_of_sum(5)::Integer == 225
+        @test square_of_sum(10)::Integer == 3025
+        @test square_of_sum(100)::Integer == 25502500
+    end
 
-@testset "Sum the squares of the numbers up to the given number" begin
-    @test sum_of_squares(1)::Integer == 1
-    @test sum_of_squares(5)::Integer == 55
-    @test sum_of_squares(10)::Integer == 385
-    @test sum_of_squares(100)::Integer == 338350
-end
+    @testset "Sum the squares of the numbers up to the given number" begin
+        @test sum_of_squares(1)::Integer == 1
+        @test sum_of_squares(5)::Integer == 55
+        @test sum_of_squares(10)::Integer == 385
+        @test sum_of_squares(100)::Integer == 338350
+    end
 
-@testset "Subtract sum of squares from square of sums" begin
-    @test difference(0)::Integer == 0
-    @test difference(1)::Integer == 0
-    @test difference(5)::Integer == 170
-    @test difference(10)::Integer == 2640
-    @test difference(100)::Integer == 25164150
+    @testset "Subtract sum of squares from square of sums" begin
+        @test difference(0)::Integer == 0
+        @test difference(1)::Integer == 0
+        @test difference(5)::Integer == 170
+        @test difference(10)::Integer == 2640
+        @test difference(100)::Integer == 25164150
+    end
 end

exercises/practice/nucleotide-count/runtests.jl

@@ -2,22 +2,24 @@ using Test
 
 include("nucleotide-count.jl")
 
-@testset "empty strand" begin
-    @test count_nucleotides("") == Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
-end
+@testset verbose = true "Nucleotide Count" begin
+    @testset "empty strand" begin
+        @test count_nucleotides("") == Dict('A' => 0, 'C' => 0, 'G' => 0, 'T' => 0)
+    end
 
-@testset "strand with one nucleotide in single-character input" begin
-    @test count_nucleotides("G") == Dict('A' => 0, 'C' => 0, 'G' => 1, 'T' => 0)
-end
+    @testset "strand with one nucleotide in single-character input" begin
+        @test count_nucleotides("G") == Dict('A' => 0, 'C' => 0, 'G' => 1, 'T' => 0)
+    end
 
-@testset "strand with repeated nucleotide" begin
-    @test count_nucleotides("GGGGGGG") == Dict('A' => 0, 'C' => 0, 'G' => 7, 'T' => 0)
-end
+    @testset "strand with repeated nucleotide" begin
+        @test count_nucleotides("GGGGGGG") == Dict('A' => 0, 'C' => 0, 'G' => 7, 'T' => 0)
+    end
 
-@testset "strand with multiple nucleotides" begin
-    @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") == Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
-end
+    @testset "strand with multiple nucleotides" begin
+        @test count_nucleotides("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC") == Dict('A' => 20, 'C' => 12, 'G' => 17, 'T' => 21)
+    end
 
-@testset "strand with invalid nucleotides" begin
-    @test_throws DomainError count_nucleotides("AGXXACT")
+    @testset "strand with invalid nucleotides" begin
+        @test_throws DomainError count_nucleotides("AGXXACT")
+    end
 end

exercises/practice/rotational-cipher/runtests.jl

@@ -2,53 +2,55 @@ using Test
 
 include("rotational-cipher.jl")
 
-@testset "rotate function" begin
-    @testset "rotate by n" begin
-        @testset "no wrap" begin
-            @test rotate(1, "a") == "b"
-            @test rotate(1, 'a') == 'b'
-            @test rotate(13, "m") == "z"
-            @test rotate(13, 'm') == 'z'
+@testset verbose = true "Rotational Cipher" begin
+    @testset "rotate function" begin
+        @testset "rotate by n" begin
+            @testset "no wrap" begin
+                @test rotate(1, "a") == "b"
+                @test rotate(1, 'a') == 'b'
+                @test rotate(13, "m") == "z"
+                @test rotate(13, 'm') == 'z'
+            end
+            @testset "wrap around" begin
+                @test rotate(13, "n") == "a"
+                @test rotate(13, 'n') == 'a'
+            end
         end
-        @testset "wrap around" begin
-            @test rotate(13, "n") == "a"
-            @test rotate(13, 'n') == 'a'
+
+        @testset "full rotation" begin
+            @test rotate(26, "a") == "a"
+            @test rotate(26, 'a') == 'a'
+            @test rotate(0, "a") == "a"
+            @test rotate(0, 'a') == 'a'
         end
-    end
 
-    @testset "full rotation" begin
-        @test rotate(26, "a") == "a"
-        @test rotate(26, 'a') == 'a'
-        @test rotate(0, "a") == "a"
-        @test rotate(0, 'a') == 'a'
+        @testset "full strings" begin
+            @test rotate(5, "OMG") == "TRL"
+            @test rotate(5, "O M G") == "T R L"
+            @test rotate(4, "Testing 1 2 3 testing") == "Xiwxmrk 1 2 3 xiwxmrk"
+            @test rotate(21, "Let's eat, Grandma!") == "Gzo'n zvo, Bmviyhv!"
+            @test rotate(13, "The quick brown fox jumps over the lazy dog.") == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
+        end
     end
 
-    @testset "full strings" begin
-        @test rotate(5, "OMG") == "TRL"
-        @test rotate(5, "O M G") == "T R L"
-        @test rotate(4, "Testing 1 2 3 testing") == "Xiwxmrk 1 2 3 xiwxmrk"
-        @test rotate(21, "Let's eat, Grandma!") == "Gzo'n zvo, Bmviyhv!"
-        @test rotate(13, "The quick brown fox jumps over the lazy dog.") == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
-    end
-end
+    # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
+    # Additional exercises                                                        #
+    # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
 
-# # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
-# Additional exercises                                                        #
-# # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # #
-
-# Bonus A
-if isdefined(@__MODULE__, Symbol("@R13_str"))
-    @eval @testset "Bonus A: string literal R13" begin
-        @test R13"The quick brown fox jumps over the lazy dog." == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
+    # Bonus A
+    if isdefined(@__MODULE__, Symbol("@R13_str"))
+        @eval @testset "Bonus A: string literal R13" begin
+            @test R13"The quick brown fox jumps over the lazy dog." == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
+        end
     end
-end
 
-# Bonus B
-if isdefined(@__MODULE__, Symbol("@R1_str"))
-    @eval @testset "Bonus B: string literals" begin
-        @test R5"OMG" == "TRL"
-        @test R4"Testing 1 2 3 testing" == "Xiwxmrk 1 2 3 xiwxmrk"
-        @test R21"Let's eat, Grandma!" == "Gzo'n zvo, Bmviyhv!"
-        @test R13"The quick brown fox jumps over the lazy dog." == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
+    # Bonus B
+    if isdefined(@__MODULE__, Symbol("@R1_str"))
+        @eval @testset "Bonus B: string literals" begin
+            @test R5"OMG" == "TRL"
+            @test R4"Testing 1 2 3 testing" == "Xiwxmrk 1 2 3 xiwxmrk"
+            @test R21"Let's eat, Grandma!" == "Gzo'n zvo, Bmviyhv!"
+            @test R13"The quick brown fox jumps over the lazy dog." == "Gur dhvpx oebja sbk whzcf bire gur ynml qbt."
+        end
     end
 end

exercises/practice/secret-handshake/runtests.jl

@@ -2,50 +2,52 @@ using Test
 
 include("secret-handshake.jl")
 
-@testset "wink for 1" begin
-    @test secret_handshake(1) == ["wink"]
-end
-
-@testset "double blink for 10" begin
-    @test secret_handshake(2) == ["double blink"]
-end
-
-@testset "close your eyes for 100" begin
-    @test secret_handshake(4) == ["close your eyes"]
-end
-
-@testset "jump for 1000" begin
-    @test secret_handshake(8) == ["jump"]
-end
-
-@testset "combine two actions" begin
-    @test secret_handshake(3) == ["wink", "double blink"]
-end
-
-@testset "reverse two actions" begin
-    @test secret_handshake(19) == ["double blink", "wink"]
-end
-
-@testset "reversing one action gives the same action" begin
-    @test secret_handshake(24) == ["jump"]
-end
-
-@testset "reversing no actions still gives no actions" begin
-    @test secret_handshake(16) == []
-end
-
-@testset "all possible actions" begin
-    @test secret_handshake(15) == ["wink", "double blink", "close your eyes", "jump"]
-end
-
-@testset "reverse all possible actions" begin
-    @test secret_handshake(31) == ["jump", "close your eyes", "double blink", "wink"]
-end
-
-@testset "do nothing for zero" begin
-    @test secret_handshake(0) == []
-end
-
-@testset "do nothing if lower 5 bits not set" begin
-    @test secret_handshake(32) == []
+@testset verbose = true "Secret Handshake" begin
+    @testset "wink for 1" begin
+        @test secret_handshake(1) == ["wink"]
+    end
+
+    @testset "double blink for 10" begin
+        @test secret_handshake(2) == ["double blink"]
+    end
+
+    @testset "close your eyes for 100" begin
+        @test secret_handshake(4) == ["close your eyes"]
+    end
+
+    @testset "jump for 1000" begin
+        @test secret_handshake(8) == ["jump"]
+    end
+
+    @testset "combine two actions" begin
+        @test secret_handshake(3) == ["wink", "double blink"]
+    end
+
+    @testset "reverse two actions" begin
+        @test secret_handshake(19) == ["double blink", "wink"]
+    end
+
+    @testset "reversing one action gives the same action" begin
+        @test secret_handshake(24) == ["jump"]
+    end
+
+    @testset "reversing no actions still gives no actions" begin
+        @test secret_handshake(16) == []
+    end
+
+    @testset "all possible actions" begin
+        @test secret_handshake(15) == ["wink", "double blink", "close your eyes", "jump"]
+    end
+
+    @testset "reverse all possible actions" begin
+        @test secret_handshake(31) == ["jump", "close your eyes", "double blink", "wink"]
+    end
+
+    @testset "do nothing for zero" begin
+        @test secret_handshake(0) == []
+    end
+
+    @testset "do nothing if lower 5 bits not set" begin
+        @test secret_handshake(32) == []
+    end
 end