forked from bigdatagenomics/avocado
-
Notifications
You must be signed in to change notification settings - Fork 2
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Factoring out Spark realigner tests.
- Loading branch information
Showing
2 changed files
with
160 additions
and
127 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
153 changes: 153 additions & 0 deletions
153
avocado-core/src/test/scala/org/bdgenomics/avocado/realigner/SparkRealignerSuite.scala
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,153 @@ | ||
/** | ||
* Licensed to Big Data Genomics (BDG) under one | ||
* or more contributor license agreements. See the NOTICE file | ||
* distributed with this work for additional information | ||
* regarding copyright ownership. The BDG licenses this file | ||
* to you under the Apache License, Version 2.0 (the | ||
* "License"); you may not use this file except in compliance | ||
* with the License. You may obtain a copy of the License at | ||
* | ||
* http://www.apache.org/licenses/LICENSE-2.0 | ||
* | ||
* Unless required by applicable law or agreed to in writing, software | ||
* distributed under the License is distributed on an "AS IS" BASIS, | ||
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. | ||
* See the License for the specific language governing permissions and | ||
* limitations under the License. | ||
*/ | ||
package org.bdgenomics.avocado.realigner | ||
|
||
import org.bdgenomics.adam.models.{ | ||
SequenceDictionary, | ||
SequenceRecord, | ||
RecordGroup, | ||
RecordGroupDictionary | ||
} | ||
import org.bdgenomics.adam.rdd.ADAMContext._ | ||
import org.bdgenomics.adam.rdd.read.{ AlignedReadRDD, AlignmentRecordRDD } | ||
import org.bdgenomics.avocado.AvocadoFunSuite | ||
import org.bdgenomics.formats.avro.AlignmentRecord | ||
|
||
trait SparkRealignerSuite extends AvocadoFunSuite { | ||
|
||
def realign(rdd: AlignmentRecordRDD, | ||
kmerLength: Int): AlignmentRecordRDD | ||
|
||
def makeAndRealignRdd(reads: Seq[AlignmentRecord], | ||
kmerLength: Int): Array[AlignmentRecord] = { | ||
val gRdd = AlignedReadRDD(sc.parallelize(reads), | ||
SequenceDictionary(SequenceRecord("ctg", 50L)), | ||
RecordGroupDictionary(Seq(RecordGroup("rg", "rg")))) | ||
|
||
// realign the genomic rdd | ||
val realignedRdd = realign(gRdd, kmerLength) | ||
|
||
// collect the reads | ||
realignedRdd.rdd.collect() | ||
} | ||
|
||
sparkTest("realign a set of reads around an insert") { | ||
// insertion sequence: | ||
// ins: AATGAGACTTACATCATTAAAACCGTGTGGACACA | ||
// ref: AATGAGACTTACATCATTAA__CCGTGTGGACACA | ||
val sequence = "AATGAGACTTACATCATTAAAACCGTGTGGACACA" | ||
val insertStart = 20 | ||
val readLength = insertStart + 6 + 2 | ||
|
||
// generate 7 reads with a 6bp flank | ||
val reads = (0 until 7).map(rId => { | ||
val basesBeforeInsert = insertStart - rId | ||
val basesAfterInsert = 6 + rId | ||
|
||
AlignmentRecord.newBuilder() | ||
.setReadName(rId.toString) | ||
.setContigName("ctg") | ||
.setRecordGroupName("rg") | ||
.setReadMapped(true) | ||
.setSequence(sequence.drop(rId).take(readLength)) | ||
.setStart(rId.toLong) | ||
.setEnd((rId + readLength - 2 + 1).toLong) | ||
.setCigar("%dM2I%dM".format(basesBeforeInsert, basesAfterInsert)) | ||
.setMismatchingPositions((readLength - 2).toString) | ||
.build() | ||
}) | ||
|
||
// make into a genomic rdd | ||
val newReads = makeAndRealignRdd(reads, 6) | ||
|
||
assert(newReads.size === 7) | ||
newReads.foreach(r => { | ||
val rId = r.getReadName.toInt | ||
|
||
// these values are different from above because original alignments were | ||
// not left justified | ||
val basesBeforeInsert = insertStart - rId - 2 | ||
val basesAfterInsert = 8 + rId | ||
|
||
assert(r.getCigar === "%d=2I%d=".format(basesBeforeInsert, basesAfterInsert)) | ||
assert(r.getMismatchingPositions === (readLength - 2).toString) | ||
}) | ||
} | ||
|
||
sparkTest("realign a set of reads around a deletion") { | ||
// deletion sequence: | ||
// del: AGGTCTGAATGAGACTTA__TCATTAACCGTGTGGACACA | ||
// ref: AGGTCTGAATGAGACTTACATCATTAACCGTGTGGACACA | ||
val sequence = "AGGTCTGAATGAGACTTATCATTAACCGTGTGGACACA" | ||
val deleteStart = 18 | ||
val readLength = deleteStart + 8 | ||
|
||
// generate 10 reads with a 8bp flank | ||
val reads = (0 until 10).map(rId => { | ||
val basesBeforeDelete = deleteStart - rId | ||
val basesAfterDelete = 8 + rId | ||
|
||
AlignmentRecord.newBuilder() | ||
.setReadName(rId.toString) | ||
.setContigName("ctg") | ||
.setRecordGroupName("rg") | ||
.setReadMapped(true) | ||
.setSequence(sequence.drop(rId).take(readLength)) | ||
.setStart(rId.toLong) | ||
.setEnd((rId + readLength + 2 + 1).toLong) | ||
.setCigar("%dM2D%dM".format(basesBeforeDelete, basesAfterDelete)) | ||
.setMismatchingPositions("%d^CA%d".format(basesBeforeDelete, basesAfterDelete)) | ||
.build() | ||
}) | ||
|
||
// make into a genomic rdd | ||
val newReads = makeAndRealignRdd(reads, 8) | ||
|
||
assert(newReads.size === 10) | ||
newReads.foreach(r => { | ||
val rId = r.getReadName.toInt | ||
|
||
// these values are different from above because original alignments were | ||
// not left justified | ||
val basesBeforeDelete = deleteStart - rId - 1 | ||
val basesAfterDelete = 9 + rId | ||
|
||
assert(r.getCigar === "%d=2D%d=".format(basesBeforeDelete, basesAfterDelete)) | ||
assert(r.getMismatchingPositions === "%d^AC%d".format(basesBeforeDelete, basesAfterDelete)) | ||
}) | ||
} | ||
|
||
sparkTest("realigning a read with a repeat will return the original read") { | ||
val read = AlignmentRecord.newBuilder() | ||
.setReadName("A_READ") | ||
.setReadMapped(true) | ||
.setStart(10L) | ||
.setEnd(17L) | ||
.setSequence("TCAAAAAAGG") | ||
.setCigar("3M4I3M") | ||
.setMismatchingPositions("6") | ||
.build() | ||
|
||
// make into a genomic rdd | ||
val newReads = makeAndRealignRdd(Seq(read), 3) | ||
|
||
// should have one read | ||
assert(newReads.size === 1) | ||
assert(newReads.head === read) | ||
} | ||
} |