Readme for FebRNA package by Tan-group at Wuhan University
FebRNA is a package for building RNA 3D structures with input their secondary structures based on coarse-grained fragment ensembles [1]. The program of FebRNA is run in Python, and numpy and scipy modules are required.
Please run FebRNA as follows:
# Compilation and usage under linux
gcc cgRNASP-Feb.c -lm -o cgRNASP-Feb
gcc reconstruction.c -lm -o reconstruction
# Run in the example dir
python ./FebRNA.py (or python3 ./FebRNA.py)
(in the file directory depending on the installed Python version) .
- (a) sequence information,
- (b) secondary structure in dot-bracket form,
- (c) number of structures required (n), and
- (d) whether all-atom construction is required accordingly.
- (a) The results are placed in the './RESULT';
- (b) './RESULT/CG_Result' contains all the predicted coarse-grained conformations;
- (c) './RESULT/Select_Result' contains a selection of TOP-n coarse-grained conformations;
- (d) './RESULT/AA_Result' contains the rebuilt all-atom structures of selected coarse-grained structures.
An example is:
python FebRNA.py
Sequence:GCGGCACCGUCCGCUCAAACAAACGG
Secondary Structure:((((..[[[.)))).........]]]
Seleted Num(0=all):5
All-atom rebuilding?(y/n):y
Finish in folder ./RESULT
Running time :37.020s
To remove possible steric clashes and chain breaks of the rebuilt all-atom structures, a structure refinement can be performed for the rebuilt all-atom structures by FebRNA through the method of QRNAS (https://github.com/sunandan-mukherjee/QRNAS.git) [2].
If you have any questions about FebRNA, please contact us by the email: [email protected] .
References:
[1] Zhou L, Wang X, Yu S, Tan YL, & Tan ZJ. 2022. FebRNA: an automated fragment-ensemble-based
model for building RNA 3D structures.
[2] Stasiewicz J, Mukherjee S, Nithin C, & Bujnicki, JM. 2019. QRNAS: software tool for refinement of
nucleic acid structures. Bmc Struct Biology, 19, 5.