-
Notifications
You must be signed in to change notification settings - Fork 28
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #71 from nextstrain/update-flu
update flu datasets and fix B/vic annotation
- Loading branch information
Showing
65 changed files
with
479,478 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
5 changes: 5 additions & 0 deletions
5
...tasets/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/genemap.gff
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,5 @@ | ||
##gff-version 3 | ||
##sequence-region CY121680.1 1 1752 | ||
CY121680.1 feature gene 21 71 . + . gene_name="SigPep" | ||
CY121680.1 feature gene 72 1052 . + . gene_name="HA1" | ||
CY121680.1 feature gene 1053 1718 . + . gene_name="HA2" |
1 change: 1 addition & 0 deletions
1
...tasets/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/primers.csv
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1 @@ | ||
Country (Institute),Target,Oligonucleotide,Sequence |
33 changes: 33 additions & 0 deletions
33
data/datasets/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/qc.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,33 @@ | ||
{ | ||
"schemaVersion": "1.2.0", | ||
"privateMutations": { | ||
"enabled": true, | ||
"typical": 5, | ||
"cutoff": 15, | ||
"weightLabeledSubstitutions": 2, | ||
"weightReversionSubstitutions": 1, | ||
"weightUnlabeledSubstitutions": 1 | ||
}, | ||
"missingData": { | ||
"enabled": false, | ||
"missingDataThreshold": 100, | ||
"scoreBias": 10 | ||
}, | ||
"snpClusters": { | ||
"enabled": false, | ||
"windowSize": 100, | ||
"clusterCutOff": 5, | ||
"scoreWeight": 50 | ||
}, | ||
"mixedSites": { | ||
"enabled": true, | ||
"mixedSitesThreshold": 4 | ||
}, | ||
"frameShifts": { | ||
"enabled": true | ||
}, | ||
"stopCodons": { | ||
"enabled": true, | ||
"ignoredStopCodons": [] | ||
} | ||
} |
2 changes: 2 additions & 0 deletions
2
...ts/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/reference.fasta
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>CY121680.1 Influenza A virus (A/California/07/2009(H1N1)) hemagglutinin (HA) gene, complete cds | ||
GGAAAACAAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACACCTAGTTCAGACAATGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGTCATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCGAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAAACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATATCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGCTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCATGAGAAAAACAC |
1,364 changes: 1,364 additions & 0 deletions
1,364
...ts/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/sequences.fasta
Large diffs are not rendered by default.
Oops, something went wrong.
25 changes: 25 additions & 0 deletions
25
.../datasets/flu_h1n1pdm_ha/references/CY121680/versions/2023-04-02T12:00:00Z/files/tag.json
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,25 @@ | ||
{ | ||
"tag": "2023-04-02T12:00:00Z", | ||
"comment": "Updated tree", | ||
"compatibility": { | ||
"nextcladeCli": { | ||
"min": "1.3.0", | ||
"max": null | ||
}, | ||
"nextcladeWeb": { | ||
"min": "1.6.0", | ||
"max": null | ||
} | ||
}, | ||
"enabled": true, | ||
"files": { | ||
"geneMap": "genemap.gff", | ||
"primers": "primers.csv", | ||
"qc": "qc.json", | ||
"reference": "reference.fasta", | ||
"sequences": "sequences.fasta", | ||
"tree": "tree.json", | ||
"virusPropertiesJson": "virus_properties.json" | ||
}, | ||
"metadata": {} | ||
} |
Oops, something went wrong.