Update README.md

phipsonlab · Nov 16, 2023 · 8660886 · 8660886
1 parent 557a223
commit 8660886
Showing 1 changed file with 17 additions and 0 deletions.
diff --git a/README.md b/README.md
@@ -58,6 +58,23 @@ The above parameters are pretty much the barebone requirement:
 * `--clone_barcodes_reference` the location of the text file containing the list of reference clone barcodes to map the reads to.
 * `--scrnaseq_bam_files` the location of the BAM file generated by cellranger.
 
+## Clone barcode reference file
+
+This is a text file where each row represents the sequence of a clone barcode.
+
+It should look something like this:
+
+```
+CGGAGTAATACATTTTGCCT
+TCGGAGTTGGCTGTCGTTTC
+GTTGTCTCGGGGGGTGGAGA
+CCATGATAAGGGAGTTCCGG
+AGGGGAGTCGCGTGGTAGGC
+TGTCTAATGGGGGTGTCACT
+```
+
+Generally, you will need to get this reference file from the lab that generates the lineage tracing barcode library for you.
+
 ## Parallelisation within sample
 
 The Python package within NextClone divides reads into several