fix icon link + 2 small bug fixes (#320)

* fix icon link

* closes #279 again (for circular seqs) (#324)

* move requests optional dependency into function body (#325)

* closes #262 (#326)

README.md

@@ -1,4 +1,4 @@
-# ![icon](https://raw.githubusercontent.com/bjornFJohansson/pydna/master/docs/pics/pydna.resized.png) pydna
+# ![icon](docs/_static/pydna.resized.png) pydna
 
 | [![Tests & Coverage](https://github.com/BjornFJohansson/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml/badge.svg?branch=dev_bjorn)](https://github.com/BjornFJohansson/pydna/actions/workflows/pydna_test_and_coverage_workflow.yml) | [![codecov](https://codecov.io/gh/BjornFJohansson/pydna/branch/master/graph/badge.svg)](https://codecov.io/gh/BjornFJohansson/pydna/branch/master) | [![PyPI version](https://badge.fury.io/py/pydna.svg)](https://badge.fury.io/py/pydna)                                                  | [![Google group : pydna](https://img.shields.io/badge/Google%20Group-pydna-blue.svg)](https://groups.google.com/g/pydna)              |
 | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------- |

src/pydna/amplify.py

@@ -344,18 +344,20 @@ def products(self):
                 if self.template.circular:
                     shift = fp.position - fp._fp
                     tpl = self.template.shifted(shift)  # shift template so that it starts where the fp starts anneling
-                    feats = tpl[: rp.position + rp._fp].features
                     fp.position = fp._fp  # New position of fp becomes the footprint length
                     rp.position = (rp.position - shift) % len(self.template)  # Shift the rp position as well
+                    feats = tpl[: rp.position + rp._fp].features
                 elif fp.position <= rp.position:  # pcr products only formed if fp anneals forward of rp
                     feats = self.template[
                         fp.position - fp._fp : rp.position + rp._fp
                     ].features  # Save features covered by primers
-                    shift_amount = len(fp.tail)
-                    feats = [_shift_feature(f, shift_amount, None) for f in feats]
                     tpl = self.template
                 else:
                     continue
+                # Shift features to the right if there was a tail
+                shift_amount = len(fp.tail)
+                feats = [_shift_feature(f, shift_amount, None) for f in feats]
+
                 if tpl.circular and fp.position == rp.position:
                     prd = _Dseqrecord(fp) + _Dseqrecord(rp).reverse_complement()
                 else:

src/pydna/tm.py

@@ -14,7 +14,6 @@
 
 import textwrap as _textwrap
 from pydna._pretty import pretty_str as _pretty_str
-import requests
 
 # See the documentation for Bio.SeqUtils.MeltingTemp for more details
 # The 10X Taq Buffer with (NH4)2SO4 is commercialized by companies like
@@ -331,6 +330,8 @@ def tmbresluc(primer: str, *args, primerc=500.0, saltc=50, **kwargs):
 
 
 def tm_neb(primer, conc=0.5, prodcode="q5-0"):
+    import requests
+
     """Calculates a single primers melting temp from NEB.
 
     Parameters

tests/test_module_amplify.py

@@ -788,6 +788,7 @@ def test_annotation():
     """
     from pydna.amplify import pcr
     from pydna.dseqrecord import Dseqrecord
+    from pydna.primer import Primer
 
     dsr = Dseqrecord("ATGCAAACAGTAATGATGGATGACATTCAAAGCACTGATTCTATTGCTGAAAAAGATAAT")
     dsr.add_feature(x=0, y=60, type="gene", label="my_gene")  # We add a feature to highlight the sequence as a gene
@@ -799,6 +800,38 @@ def test_annotation():
 
     assert pcr_product.features[0].location.extract(pcr_product).seq == dsr.seq
 
+    # Also works in circular sequences
+    dsr_circ = dsr.looped()
+    pcr_product_circ = pcr(forward_primer, reverse_primer, dsr_circ)
+    assert str(pcr_product_circ.features[0].location.extract(pcr_product_circ).seq) == str(dsr_circ.seq)
+
+    # Check that annotations are transmitted properly if the PCR product spans
+    # the origin in a circular sequence
+
+    vector = Dseqrecord(
+        "ATGCAAACAGTAATGATGGATGACACCAGCTTCATGAAATGGAACAGTGCCAGAAAAAACTTGAAGATGTTCAAAGCACTGATTCTATTGCTGAAAAAGATAAT",
+        circular=True,
+    )
+
+    vector.add_feature(17, 40, type_="test", label=["left"])
+    vector.add_feature(41, 90, type_="test", label=["right"])
+    vector.add_feature(17, 90, type_="test", label=["all"])
+    vector.add_feature(30, 60, type_="test", label=["middle"])
+
+    feature_seqs = set(str(f.location.extract(vector).seq) for f in vector.features)
+
+    for shift in range(len(vector)):
+        shifted_vector = vector.shifted(shift)
+
+        primer_f = Primer("acgtGGATGACACCAGCTTCAT")
+        primer_r = Primer("attacCAATAGAATCAGTGCTTTGAACA")
+
+        product = pcr(primer_f, primer_r, shifted_vector)
+
+        product_seqs = set(str(f.location.extract(product).seq) for f in product.features if f.type == "test")
+
+        assert product_seqs == feature_seqs, f"Shift {shift}"
+
 
 if __name__ == "__main__":
     pytest.main([__file__, "-vv", "-s"])